|
ATCC
virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus Virus Forward Primer Reverse Primer Length Bp Rice Dwarf Virus Cgatcccgggaat Tcgga Ccgaattcccggg Atcc 525 Rice Stripe Virus, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus/product/ATCC Average 94 stars, based on 1 article reviews
virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
sivspecific reverse primer Sivspecific Reverse Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sivspecific reverse primer/product/Thermo Fisher Average 95 stars, based on 1 article reviews
sivspecific reverse primer - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reverse transcription primers oligo Reverse Transcription Primers Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse transcription primers oligo/product/Thermo Fisher Average 97 stars, based on 1 article reviews
reverse transcription primers oligo - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
New England Biolabs
reverse gcgcgggcccacgtagtacggg primers Reverse Gcgcgggcccacgtagtacggg Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse gcgcgggcccacgtagtacggg primers/product/New England Biolabs Average 99 stars, based on 1 article reviews
reverse gcgcgggcccacgtagtacggg primers - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Toyobo
reverse primers Reverse Primers, supplied by Toyobo, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primers/product/Toyobo Average 98 stars, based on 1 article reviews
reverse primers - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reverse primer Reverse Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer/product/Thermo Fisher Average 96 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
1353 reverse hindiii primers 1353 Reverse Hindiii Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1353 reverse hindiii primers/product/New England Biolabs Average 99 stars, based on 1 article reviews
1353 reverse hindiii primers - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
TaKaRa
reverse primer Reverse Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer/product/TaKaRa Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
TaKaRa
primer transcript ii reverse transcriptase Primer Transcript Ii Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer transcript ii reverse transcriptase/product/TaKaRa Average 96 stars, based on 1 article reviews
primer transcript ii reverse transcriptase - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |