Review





Similar Products

94
ATCC virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus
Virus Forward Primer Reverse Primer Length Bp Rice Dwarf Virus Cgatcccgggaat Tcgga Ccgaattcccggg Atcc 525 Rice Stripe Virus, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus/product/ATCC
Average 94 stars, based on 1 article reviews
virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

95
Thermo Fisher sivspecific reverse primer
Sivspecific Reverse Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sivspecific reverse primer/product/Thermo Fisher
Average 95 stars, based on 1 article reviews
sivspecific reverse primer - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

97
Thermo Fisher reverse transcription primers oligo
Reverse Transcription Primers Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse transcription primers oligo/product/Thermo Fisher
Average 97 stars, based on 1 article reviews
reverse transcription primers oligo - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

99
New England Biolabs reverse gcgcgggcccacgtagtacggg primers
Reverse Gcgcgggcccacgtagtacggg Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse gcgcgggcccacgtagtacggg primers/product/New England Biolabs
Average 99 stars, based on 1 article reviews
reverse gcgcgggcccacgtagtacggg primers - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

98
Toyobo reverse primers
Reverse Primers, supplied by Toyobo, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primers/product/Toyobo
Average 98 stars, based on 1 article reviews
reverse primers - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

96
Thermo Fisher reverse primer
Reverse Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer/product/Thermo Fisher
Average 96 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

99
New England Biolabs 1353 reverse hindiii primers
1353 Reverse Hindiii Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1353 reverse hindiii primers/product/New England Biolabs
Average 99 stars, based on 1 article reviews
1353 reverse hindiii primers - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

99
TaKaRa reverse primer
Reverse Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer/product/TaKaRa
Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

96
TaKaRa primer transcript ii reverse transcriptase
Primer Transcript Ii Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer transcript ii reverse transcriptase/product/TaKaRa
Average 96 stars, based on 1 article reviews
primer transcript ii reverse transcriptase - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

Image Search Results